Assay details 
Record creation : 2002-07-16
Last update : 2009-10-09
Score :
3/15
Application :
Gene Expression Quantification/Detection
GXP
Detection :
SYBR Green I
SYB
Template :
cDNA
The assay is designed for the analysis of the following gene
1.
Target gene
Organism :
Homo sapiens
Official symbol :
GAPDH
Official name :
glyceraldehyde-3-phosphate dehydrogenase
Aliases :
G3PD, GAPD, MGC88685
Entrez Gene ID :
Ensembl ID :
Chrom. position :
12p13
Primers and/or probes
Forward primer :
TGCACCACCAACTGCTTAGC (20 bp)
Reverse primer :
GGCATGGACTGTGGTCATGAG (21 bp)
Amplicon :
TGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGG
ACTCATGACCACAGTCCATGCC
(87 bp)
Annealing temperature :
60 °C
 
Sequence evaluation
Forward primer : TGCACCACCAACTGCTTAGC (20 bp)
Alignment : Perfect alignment with RefSeq NM_002046 from base 555 to 575
SNP's : None detected
 
Reverse primer : GGCATGGACTGTGGTCATGAG (21 bp)
Alignment : Perfect alignment with RefSeq NM_002046 from base 621 to 642
SNP's : ------------------N----
Alignments on 1 transcript
NM_002046 (Exons: 0, Transcript length: 1310 bp)
Submitter
Steve Lefever ( steve.lefever@ugent.be )
UGent, Center for Medical Genetics Ghent
De Pintelaan 185, 9000 Gent, Belgium
Feedback 
Click here to add feedback
Publications 
1.
Vandesompele, Jo; De Preter, Katleen; Pattyn, Filip; Poppe, Bruce; Van Roy, Nadine; De Paepe, Anne; Speleman, Frank.
Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.
Genome Biol. 2002 Jun; 3(7):RESEARCH0034