Assay details 
Record creation : 2002-07-16
Last update : 2009-10-09
Score :
3/15
Application :
Gene Expression Quantification/Detection
GXP
Detection :
SYBR Green I
SYB
Template :
cDNA
Primers and/or probes
Forward primer :
TGCACCACCAACTGCTTAGC (20 bp)
Reverse primer :
GGCATGGACTGTGGTCATGAG (21 bp)
Amplicon :
TGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGG
ACTCATGACCACAGTCCATGCC
(87 bp)
Annealing temperature :
60 °C
 
Sequence evaluation
No successfull alignments
Submitter
Steve Lefever ( steve.lefever@ugent.be )
UGent, Center for Medical Genetics Ghent
De Pintelaan 185, 9000 Gent, Belgium
Feedback 
Click here to add feedback
Table 'biblioDB.bibref' doesn't exist